Научный журнал
Международный журнал прикладных и фундаментальных исследований

ISSN 1996-3955
ИФ РИНЦ = 0,580

ВЛИЯНИЕ СЕЛЕНИТА НАТРИЯ НА ЖИЗНЕСПОСОБНОСТЬ РАКОВЫХ КЛЕТОК СЕМЕННИКОВ МЫШИ И ЭКСПРЕССИЮ МРНК СЕЛЕНОПРОТЕИНОВ SELV (SELENOPROTEIN V), TGR (THIOREDOXIN-GLUTATHION REDUCTASE) И GPX4 (GLUTATHION PEROXIDASE 4) В НИХ

Гольтяев М.В. 1 Варламова Е.Г. 1
1 ФГБУН институт биофизики клетки РАН
Одним из наиболее распространенных соединений селена, рассматриваемых в качестве потенциального противоракового агента, способного индуцировать образование АФК, торможение роста клеток, влиять на экспрессию проапоптотических генов и др., является селенит натрия. В работе исследовано влияние различных концентраций селенита натрия на жизнеспособность раковых клеток семенников мыши и его роль в регуляции экспрессии мРНК трех селенопротеинов, локализующихся в семенниках и вовлеченных в процессы сперматогенеза млекопитающих. Учитывая важную роль селенопротеинов в регуляции процессов канцерогенеза, в первую очередь в качестве антиоксидантов, результаты данной работы являются весьма актуальными. Существенное снижение жизнеспособности раковых клеток линии F-9 наблюдался при использовании 7.5 и 10.0 мкМ концентраций SS. Методом ПЦР в реальном времени выявлено, что при обработке клеток SS происходило увеличение экспрессии мРНК GPX4 и существенное снижение экспрессии мРНК TGR. Эти результаты не согласуются с ранее полученными данными о совместном функционировании двух ферментов в семенниках и дают основание полагать, что TGR может обладать онкогенными свойствами. Ни до, ни после действия на клетки SS мРНК SELV не была обнаружена, поэтому говорить об его участии/неучастии в процессах злокачественной трансформации рано. Результаты, полученные методом ПЦР в реальном времени, нашли своё подтверждение и при выполнении вестерн-блоттинга, и их можно рассматривать как начальный этап исследований роли селенопротеинов SELV, TGR и GPX4 в канцерогенезе.
селенит натрия (SS)
тератокарцинома семенников
селенопротеины
селен (Se)
активные формы кислорода (АФК)
1. Shigemi Z., Manabe K., Hara N., Baba Y., Hosokawa K., Kagawa H., Watanabe T., Fujimuro M. Methylseleninic acid and sodium selenite induce severe ER stress and subsequent apoptosis through UPR activation in PEL cells // Chem. Biol. Interact. – 2017. – vol. 266. – Р. 28–37.
2. Chan J.M., Darke A.K., Penney K.L., Tangen C.M., Goodman P.J., Lee G.M., Sun T., Peisch S., Tinianow A.M., Rae  J.M., Klein E.A., Thompson I.M., Kantoff P.W., Mucci  L.A. Selenium- or vitamin E-related gene variants, interaction with supplementation, and risk of high-grade prostate cancer in SELECT // Cancer Epidemiol. Biomarkers Prev. – 2016. – vol. 25, no. 7. – Р. 1050–1058.
3. Varlamova E.G., Cheremushkina I.V. Contribution of mammalian selenocysteine-containing proteins to carcinogenesis // J. Trace Elem. Med. Biol. – 2017. – vol. 39, no. 1. – Р. 76–85.
4. Varlamova E.G., Goltyaev M.V., Fesenko E.E. Expression of human selenoprotein genes selh, selk, selm, sels, selv and gpx-6 in various tumor cell lines // Dokl. Biochem. Biophys. – 2016. – vol. 468, no. 1. – Р. 203–205.
5. Guan L., Han B., Li Z., Hua F., Huanq F., Wei W., Yang  Y., Xu C. Sodium selenite induces apoptosis by ROS-mediated endoplasmic reticulum stress and mitochondrial dysfunction in human acute promyelocytic leukemia NB4 cells // Apoptosis. – 2009. – vol. 14, no. 2. – Р. 218–225.
6. Han B., Ren Y., Guan L., Wei W., Hua F., Yang Y., Yang  T., Cao T., Dong H., Pan H., Xu C. Sodium selenite induces apoptosis in acute promyelocytic leukemia-derived NB4 cells through mitochondria-dependent pathway // Oncol. Res. – 2009. – vol. 17, no. 8. – Р. 373–381.
7. Kryukov G.V., Castellano S., Novoselov S.V., lobanov A.V., Zehtab O., Guiqo R., Gladyshev V.N. Characterization of mammalian selenoproteomes // Scienc. – 2003. – vol. 300, no. 5624. – Р. 1439–1443.
8. Варламова Е.Г. Внутриклеточная локализация селеновых белков млекопитающих: SELV (Selenoprotein V) и GPX6 (Glutathionperoxidase 6) / Е.Г. Варламова // Фундаментальные исследования. – 2011. – № 9. – C. 326–330.
9. Varlamova E.G., Novoselov S.V., Novoselov V.I. cDNA cloning and the expression and determination of substrate specificity of mice selenocysteine-containing protein SELV (Selenoprotein  V) // Mol. Biol. (Mosk.). – 2015. – vol. 49, no. 5. – Р. 700–704.
10. Varlamova E.G., Novoselov V.I. The search of partners of a new mammalian selenium-containing protein V (SelV) and expression it’s mRNA during ontogenesis and spermatogenesis // Mol. Biol. (Mosk). – 2012. – vol. 46, no. 2. – Р. 276–284.
11. Goltyaev M.V., Varlamova E.G., Novoselov V.I., Fesenko E.E. Determination of mgpx6 and mselv gene mRNA expression during mouse postnatal development // Dokl. Biochem. Biophys. – 2014. – vol. 457, no. 2. – Р. 132–133.
12. Maiorino M., Wissing J.B., Brigelius-Flohe R., Calabrese F., Roveri A., Steinert P., Ursini F., Flohe L. Testosterone mediates expression of the selenoprotein PHGPx by induction of spermatogenesis and not by direct transcriptional gene activation // FASEB J. – 1998. – vol. 12, no. 13. – Р. 1359–1370.
13. Schneider M., Fоrster H., Boersma A., Seiler A., Wehnes H., Sinowatz F., Neumüller C., Deutsch M.J., Walch A., Hrabé de Angelis M., Wurst W., Ursini F., Roveri A., Maleszewski  M., Maiorino M., Conrad M. Mitochondrial glutathione peroxidase 4 disruption causes male infertility // FASEB J. – 2009. – vol. 23, no.9. – Р. 3233–3242.
14. Sun Q.A., Kirnarsky L., Sherman S., Gladyshev V.N. Selenoprotein oxidoreductase with specificity for thioredoxin and glutathione systems // Proc. Natl. Acad. Sci. USA. – 2001. – vol. 98, no. 7. – Р. 3673–3678.
15. Su D., Novoselov S.V., Sun Q.A., Moustafa M.E., Zhou  Y., Oko R., Hatfi eld D.L., Gladyshev V.N. Mammalian selenoprotein thioredoxin-glutathione reductase. Roles in disulfide bond formation and sperm maturation // J. Biol. Chem. – 2005. – vol. 280, no. 28. – Р. 26491–26498.

В последние годы накапливается всё больше информации о роли Se в регуляции процессов канцерогенеза [1–4]. Наиболее распространенным соединением Se, рассматриваемым в качестве потенциального противоракового агента, способного индуцировать образование активных форм кислорода (АФК) в опухолевых клетках, торможение их роста, влиять на экспрессию проапоптотических генов и др., является SS [1, 5, 6]. Кроме того, Se является компонентом 25 селенопротеинов млекопитающих, которые могут выступать как в качестве опухолевых супрессоров, так и обладать онкогенными свойствами [3], участвовать в поддержании оптимального антиоксидантного статуса в клетке, а также в регенерации и активации низкомолекулярных антиоксидантов (Q10, витаминов С и Е и др.). Поскольку одной из причин развития рака является усиление окислительного стресса в клетках, соединения селена рассматривают в качестве противоопухолевых агентов, однако этот эффект в значительной степени зависит от дозы и химической специфики. Известно, что более половины селенопротеинов млекопитающих обнаружены в семенниках, тогда как три из них (SELV, TGR и GPX4) локализуются и функционируют преимущественно в данном органе [7], но являются малоизученными. Ранее нами показано, что SELV- ядерно-цитоплазматический белок с глутатионпероксидазной и тиоредоксинредуктазной активностями [8, 9], мРНК SELV экспрессируется на протяжении всего постнатального развития, особенно в период полового созревания, в связи с чем рассматривается участие белка в процессах сперматогенеза и поддержания нормальной репродуктивной функции животных [10, 11]. Глутатионпероксидаза GPX4 экспрессируется на поздних стадиях сперматогенеза в сперматидах и участвует в процессах конденсации мужского гаплоидного генома, при его инактивации наблюдаются серьезные структурные нарушения в средней части сперматозоидов, ухудшение качества спермы, что может привести к бесплодию [12, 13]. TGR по своей структуре похож на две другие тиоредоксинредуктазы млекопитающих, но имеет дополнительный глутаредоксиновый домен на N-конце. Фермент преимущественно экспрессируется в семенниках, в ранних сперматидах и участвует в окислительно-восстановительных реакциях в процессе созревания сперматозоидов [14]. У мышей с недостатком Se выявлено снижение подвижности сперматозоидов и нарушение их морфологии, особенно в средней части, что согласуется с данными, полученными для GPX4 [13]. Наличие параллельной пространственной и временной экспрессии GPX4 и TGR, а также участие TGR в изомеризации дисульфидных связей, формирующихся между GPX4 и определенными белками сперматозоидов, предполагает, что оба фермента связаны функционально [15]. Однако до сих пор слабо исследована роль данных селенопротеинов в регуляции процессов канцерогенеза, в частности связанных с раком семенников, поэтому результаты, полученные в ходе данной работы, представляют весомый интерес.

Цель исследования

Изучить влияние SS на жизнеспособность раковых клеток семенников мыши, линия F-9 (тестикулярная тератокарцинома мыши), а также на уровень экспрессии мРНК генов трех селенопротеинов SELV, TGR и GPX4 в данной клеточной линии до и после воздействия SS.

Материалы и методы исследования

Выделение РНК. Тотальную РНК из клеток F-9 (ЦКП «Коллекция культур клеток позвоночных», Санкт-Петербург) выделяли с помощью реагента Extract tRNA reagent («Евроген», Россия), содержащего раствор фенола и гуанидинизотиоционата. Реагент вносили на чашку Петри с клеточным монослоем из расчета 1 мл на 10 см2 поверхности, выделение РНК согласно протоколу производителя.

Обратная транскрипция. Реакцию обратной транскрипции проводили с использованием набора реагентов для синтеза первой цепи кДНК («Евроген», Россия), содержащего ревертазу MMLV в присутствии oligo(dT)-праймеров. Используемое в реакции содержание суммарной РНК (2 мкг) контролировали, проводя параллельно амплификацию с праймерами к гену «домашнего хозяйства» GAPDH.

ПЦР в реальном времени. Полученную кДНК использовали в качестве матрицы для проведения ПЦР в реальном времени с помощью смеси qPCRmix-HS SYBR («Евроген», Россия) и праймеров, приведенных в таблице. Изменение уровня экспрессии мРНК до и после обработки SS, определяли по формуле

ОУЭ = 2-ΔΔСт ,

где ΔСт – разница между значениями пороговых циклов для референсного (GAPDH-ген, кодирующий глицеральдегид-3-фосфат дегидрогеназу) и целевого генов (гены исследуемых селенопротеинов), ΔΔСт – разница значений ΔСт для каждого гена до и после обработки клеток SS. Каждый цикл эксперимента (выделение РНК, реакция обратной транскрипции, ПЦР в реальном времени) повторяли трижды.

Анализ вестерн-блот. Для идентификации исследуемых белков использовали метод иммуноблотинга, для чего клетки отмывали фосфатно-солевым буфером и центрифугировали при 1 000 об/мин в течение 20 мин. Супернатант концентрировали с помощью центрифужных концентраторов Amicon Ultra 4–50 кДа («Merk Millipore», Россия), полученные образцы использовали для проведения ПААГ электрофореза в 10 % разрешающем геле. Далее выполняли иммуноблотинг с коммерческими антителами против исследуемых селенопротеинов и контрольного гена-GAPDH и вторичными антителами, конъюгированными с пероксидазой хрена («Abcam», США).

Анализ жизнеспособности клеток после обработки SS. Для исследования жизнеспособности клеток в режиме реального времени – до, в момент и после оказания на них воздействия использовали анализатор iCelligence RTCA («ACEA Biosciences®», США). Предварительно подбирали концентрации SS («Sigma-Aldrich», США), существенно снижающих жизнеспособность раковых клеток. Клетки подращивали в специальных планшетах прибора в 500 мкл питательной среды (DMEM, 10 % сыворотка) при 37 °С в течение 24 ч, после чего добавляли раствор SS в концентрациях 1, 2,5, 5,0, 7,5 и 10,0 мкМ. Клетки инкубировали еще 48 ч, при 37 °С, замеряя при этом клеточный индекс-показатель сопротивления электронного потока клеткам, находящимся в адгезивном состоянии, который вычисляли по формуле: (значение сопротивления в момент времени n–значение сопротивления в отсутствие клеток)/номинальное значение сопротивления. Процедуру повторяли трижды.

Последовательности праймеров, используемых для проведения реакции ПЦР в реальном времени

п/п

Название праймера

Последовательность прямого праймера 5’->3’

Последовательность обратного праймера 5’->3’

1

GAPDH

AACGGGAAGCTCACTGGC

CACCACCCTGTTGCTGTAGC

2

SELV

CCAGGTTACAGGGGAGTTTG

CAGCCACCATCAGAAAAGG

3

TGR

TGGTCGTGACTCCTGTACAAG

CCACATTTCATTGCAGCTG

4

GPX4

CCATGCACGAGTTTTCCG

AATTTGACGTTGTAGCCCG

 

golt1.tif

Рис. 1. Жизнеспособность клеток линии F-9 до и после обработки SS в концентрации 1; 2,5; 5; 7,5 или 10 мкМ. SS добавляли через 24 ч после инкубации клеток в анализаторе. Стрелкой обозначен момент добавления SS к клеткам; измерение клеточного индекса проводили в течение 48 ч

Результаты исследования и их обсуждение

Анализ жизнеспособности клеток после обработки SS. Все используемые в данной работе концентрации SS (1; 2,5; 5,0; 7,5 и 10,0 мкМ) приводили к снижению жизнеспособности раковых клеток линии F-9 (рис. 1), наибольший эффект был достигнут при использовании 7,5 и 10,0 мкМ концентраций SS, что соответствует ранее полученным данным на клетках первичной эффузионной лимфомы (линия PEL) [1]. С химиотерапевтической точки зрения подбор концентрации SS является важным этапом в исследовании дозозависимого действия данного агента на конкретную клеточную линию, а также механизма, приводящего к гибели раковых клеток. Se, благодаря своей уникальной способности быть избирательно токсичным для опухолевых клеток и не влиять на нормальные при его использовании в клинически допустимых субтоксичных дозах, рассматривается в качестве перспективного химиотерапевтического средства. В экспериментах по изучению влияния SS на регуляцию экспрессии мРНК SELV, TGR и GPX4 клетки F-9 обрабатывали 10.0 мкМ SS, анализ проводили спустя 24 ч воздействия.

Анализ регуляции SS на экспрессию мРНК SELV, TGR и GPX4. К настоящему времени доказана связь между действием SS и стрессом эндоплазматического ретикулума, опосредованным высоким уровнем АФК. Поскольку большинство селенопротеинов обладают антиокидантными свойствами, благодаря селеноцистеину, входящему в их состав, весьма интересным явилось установление изменения уровней экспрессии мРНК генов трех исследуемых в данной работе селенопротеинов.

golt2a.tif

А

golt2b.tif

Б

Рис. 2. А. Экспрессия генов селенопротеинов SELV, TGR и GPX4 в клетках F-9 до и после воздействия SS. А. Уровни мРНК SELV, TGR и GPX4 до (1) и после обработки 10 мкМ SS в течение 24 ч (2) относительно мРНК GAPDH (отн. ед.). За единицу принят уровень каждой из исследуемых мРНК в необработанных клетках. Значения представлены как среднее ± SD по трем независимым экспериментам. Б. Электрофоретический анализ белков SELV, TGR и GPX4 до (1) и после обработки SS (2)

На рис. 2, А, представлены результаты ПЦР в реальном времени, которые свидетельствуют о том, что при обработке клеток SS происходило увеличение экспрессии мРНК GPX4, что ожидаемо в условиях усиленного окислительного стресса, вызванного действием SS, поскольку известно, что системы глутаредоксина и тиоредоксина являются основными в поддержании редокс гомеостаза в клетке. Однако обратный эффект наблюдался для гена TGR, для которого установлено существенное снижение экспрессии. Эти результаты не согласуются с ранее полученными данными о совместном функционировании двух ферментов в семенниках [13–15] и дают основание полагать, что TGR может обладать онкогенными свойствами. Безусловно, эти предположения требуют подтверждения в более детальных исследованиях, где будет проанализировано влияние подавления экспрессии гена TGR в нормальных и раковых клетках семенников на пролиферацию клеток, экспрессию генов других селенопротеинов, опухолевых маркеров и др. Что касается третьего белка SELV, его мРНК не была обнаружена ни до, ни после действия на клетки SS, поэтому говорить об его участии/неучастии в процессах злокачественной трансформации рано. Результаты, полученные методом ПЦР в реальном времени, нашли своё подтверждение и при выполнении вестерн-блот анализа (рис. 2, Б).

Заключение

В настоящее время у исследователей в области биологии и медицины имеется понимание важности окислительно-восстановительных процессов для жизнедеятельности организмов в норме и при патологиях. Известно, что существует широкий спектр биологических молекул с антиоксидантными свойствами, которые классифицированы по ряду признаков, среди которых важную роль играют соединения Se. Поскольку одной из причин развития рака является усиление окислительного стресса в клетках, соединения Se рассматривают в качестве противоопухолевых агентов, однако этот эффект в значительной степени зависит от дозы и химической специфики. Однако результаты, полученные в данной работе, можно рассматривать как начальный этап исследований роли селена и селенопротеинов SELV, TGR и GPX4 в канцерогенезе, они требуют дальнейшего подтверждения в более серьезных исследованиях, направленных на изучение изменений, вызванных SS в раковых и нормальных клетках семенников с помощью различных независимых подходов: сайленсинг генов исследуемых селенопротеинов, анализ изменения экспрессии генов других селенопротеинов, опухолевых маркеров, а также известных участников регуляции ЭПР-стресса и др.

Работа поддержана стипендией Президента Российской Федерации молодым ученым и аспирантам СП-2059.2016.4 и грантами РФФИ № 17-04-00356А, 18-34-00118 мол_а.


Библиографическая ссылка

Гольтяев М.В., Варламова Е.Г. ВЛИЯНИЕ СЕЛЕНИТА НАТРИЯ НА ЖИЗНЕСПОСОБНОСТЬ РАКОВЫХ КЛЕТОК СЕМЕННИКОВ МЫШИ И ЭКСПРЕССИЮ МРНК СЕЛЕНОПРОТЕИНОВ SELV (SELENOPROTEIN V), TGR (THIOREDOXIN-GLUTATHION REDUCTASE) И GPX4 (GLUTATHION PEROXIDASE 4) В НИХ // Международный журнал прикладных и фундаментальных исследований. – 2018. – № 2. – С. 137-141;
URL: http://www.applied-research.ru/ru/article/view?id=12123 (дата обращения: 27.02.2021).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074