Научный журнал
Международный журнал прикладных и фундаментальных исследований

ISSN 1996-3955
ИФ РИНЦ = 0,580

СВЯЗЬ АЛЛЕЛЯ T ЗАМЕНЫ XR_928434.1:N.1748 + 4013T > C С МИГРЕНЬЮ, ПУЧКОВОЙ И ХРОНИЧЕСКОЙ ГОЛОВНЫМИ БОЛЯМИ

Наумова Е.А. 1 Азимова Ю.Э. 2 Кондратьева Н.С. 1 Анучина А.А. 1 Сергеев А.В. 2, 3 Скоробогатых К.В. 2 Кокаева З.Г. 1 Рудько О.И. 1 Табеева Г.Р. 2, 3 Климов Е.А. 1, 4
1 Московский государственный университет имени М.В. Ломоносова
2 Университетская клиника головной боли
3 НИЦ Первого Московского государственного медицинского университета им. И.М. Сеченова
4 Университетская диагностическая лаборатория
В результате первого полногеномного ассоциативного исследования (GWAS) обычной мигрени обнаружена замена в регуляторной области гена MTDH (rs1835740, XR_928434.1:n.1748 + 4013T > C). Однако подтвердить данные GWAS на независимых выборках не удалось. Так же нет однозначного ответа о роли данной замены в формировании клинической картины различных форм мигрени. В нашем исследовании была оценена роль замены rs1835740 на клиническую картину различных форм мигрени (эпизодическая, хроническая), а также выявить специфичность данного маркёра для мигрени по сравнению с другими формами головной боли (пучковая головная боль, хроническая головная боль напряжения). Нами не обнаружено влияния аллеля Т (rs1835740) на формирование клинической картины мигрени с аурой и мигрени без ауры. Также нами показано, что полиморфизм rs1835740 не оказывает влияния на хронификацию мигрени. Между тем, носительство аллеля Т является специфичным для пациентов с мигренью и пучковой головной болью, и не характерно для пациентов с хронической головной болью напряжения.
XR_928434.1:n.1748 + 4013T > C
MTDH
rs1835740
мигрень
аура
хроническая мигрень
пучковая головная боль
хроническая головная боль напряжения
1. Russell M.B., Olesen J. Increased familial risk and evidence of genetic factor in migraine // BMJ. 1995. – V. 311. – P. 541–544.
2. van den Maagdenberg A.M., et al. Genetics of headaches // Handb Clin Neurol. – 2010. – V. 97. – P. 85–97.
3. Anttila V., et al. Genome-wide association study of migraine implicates a common susceptibility variant on 8q22.1. // Nat Genet. – 2010. – V. 42. – P. 869–873.
4. Sintas C., et al. A replication study of a GWAS finding in migraine does not identify association in a Spanish case-control sample // Cephalalgia. – 2012. – V. 32. – P. 1076–1080.
5. Andreou A.P., Goadsby P.J. Therapeutic potential of novel glutamate receptor antagonists in migraine // Expert Opin Investig Drugs. – 2009. – V. 18. – P. 789–803.
6. Silva E., et al. Extracellular glutamate, aspartate and arginine increase in the ventral posterolateral thalamic nucleus during nociceptive stimulation // Brain Res. – 2001. – V. 923. – P. 45–49.
7. Esserlind A.-L., et al. A genotype–phenotype analysis of the 8q22.1 variant in migraine with aura // Eur J Neurol. – 2012. – V. 19. – P. 603–609.
8. Christensen A.F., et al. Genotype-phenotype correlation in migraine without aura focusing on the rs1835740 variant on 8q22.1 // J Headache Pain. – 2012. – V. 13. – № 1. – P. 21–27.
9. Aurora S.K., Wilkinson F. The brain is hyperexcitable in migraine // Cephalalgia. – 2007. – V. 27. – P. 1442–1453.
10. Schurks M., et al. Cluster headache: clinical presentation, lifestyle features, and medical treatment // Headache. – 2006. – V. 46. – P. 1246–1254.

Наследственная предрасположенность к развитию мигрени хорошо известна и доказана эпидемиологическими генетическими исследованиями [6]. Изучение генома в семьях пациентов с гемиплегической мигренью позволило выявить пять типов мигрени с моногенным наследованием (семейная гемиплегическая мигрень I, II, III, IV, V). Однако эти формы встречаются исключительно редко, и в развитии обычной мигрени с аурой или без ауры участия не принимают [10]. Первое полногеномное исследование (GWAS) обычной мигрени было опубликовано в 2010 году [2]. В это исследование вошли почти 6 тысяч пациентов с мигренью с аурой или без ауры из различных стран Европы (Голландия, Дания, Финляндия, Германия, Исландия) и более 40 тысяч здоровых лиц. Исследование позволило выявить, что наличие минорного аллеля Т замены rs1835740 (XR_928434.1:n.1748 + 4013T > C) в локусе 8q22.1 повышает риск развития мигрени, в особенности мигрени с аурой. Однако, в исследовании «случай-контроль», проведённом в испанской популяции, включившем 1521 пациента с мигренью и 1379 здоровых, достоверных различий частот аллелей rs1835740 не было получено [9].

Замена rs1835740 находится между генами MTDH (metadherin) и PGCP, которые вовлечены в обмен глутамата. При количественном анализе транскрипционной активности гена MTDH в линии лимфобластоидных клеток было обнаружено, что уровень экспрессии имеет значительную корреляцию с данной заменой – минорный вариант Т ассоциирован с высоким уровнем транскрипционной активности гена [2]. В более ранних исследованиях было показано, что MTDH негативно регулирует уровень экспрессии гена SLC1A2 (известный также как EEAT1), кодирующего основной белок-переносчик глутамата [1]. Наличие аллеля Т rs1835740 ведет к накоплению внеклеточного глутамата, активирующего участвующие в центральной сенсибилизации НМДА-рецепторы, что снижает порог нейрональной возбудимости [8]. Кроме того, эта замена находится недалеко от гена PGCP, кодирующего глутамат-карбоксипептидазу – активатора активности астроцитов и, следовательно, происходит снижение порога возникновения распространяющейся корковой депрессии, основного патофизиологического коррелята ауры мигрени [2].

Можно предположить, что полиморфизм rs1835740 обуславливает более тяжелое течение мигрени. В исследовании Esserlind с соавторами [5], в которое вошли 691 пациент с мигренью с аурой, изучались детали клинических проявлений мигрени в зависимости от генотипа (42 % оказались носителями Т-аллеля). Носители Т-аллеля имели тенденцию к большей представленности симптомов во время ауры, а также к меньшей выраженности головной боли и представленности сопутствующих симптомов. У гомозигот ТТ эти клинические особенности не были более выражены. Авторами был сделан вывод, что Т-аллель замены rs1835740 увеличивает риск развития мигрени, но не влияет на симптомообразование мигрени с аурой.

В исследовании Christensen с соавторами [4] проводился фенотипический анализ носителей Т-аллеля rs1835740 среди пациентов с мигренью без ауры. Было включено 339 пациентов, 40 % были носителями T-аллеля. Не было получено достоверных различий по представленности характеристик и симптомов приступов мигрени, по наличию коморбидных расстройств, по представленности триггеров мигренозного приступа, по влиянию изменений гормонального фона (беременность, прием КОК, постменопауза) на частоту приступов мигрени, а также по эффективности триптанов и превентивной терапии.

Эти исследования не дают однозначный ответ о роли полиморфизма rs1835740 на клиническую картину различных форм мигрени. Целью нашего исследования было выяснить влияние однонуклеотидного полиморфизма rs1835740 на клиническую картину различных форм мигрени (эпизодическая и хроническая), а также выявить специфичность данного биомаркёра для мигрени по сравнению с другими формами головной боли (пучковая головная боль, хроническая головная боль напряжения).

Материалы и методы исследования

Пациенты. В исследование вошли 143 пациента с мигренью, средний возраст составил 41.6 ± 12.5 лет (67.8 % – с эпизодической мигренью, 32.2 % – хронической мигренью, 18.5 % – с мигренью с аурой, 31.9 % злоупотребляли обезболивающими средствами). Группы сравнения составили 9 пациентов с пучковой головной болью и 20 пациентов с хронической головной болью напряжения. Группу контроля составили 362 здоровых испытуемых. Пациенты основной группы, групп сравнения и контроля были сопоставимы по возрасту. Диагноз формы головной боли устанавливался на основании критериев Международной классификации головных болей III (2013). Пациентам проводилось клинико-неврологическое обследование и забор крови для генотипирование. Исследование одобрено локальным этическим комитетом, все испытуемые давали информированное согласие на участие в исследовании.

Молекулярно-генетическое исследование и анализ данных. Выделение ДНК проводили согласно протоколу к коммерческому набору ДНК MagnaTM DNA Prep 200 (ООО «Лаборатория ИзоГен», Москва). Оценку аллельных состояний изучаемых замен проводили методом ПЦР в реальном времени. Праймеры, флуоресцентные зонды к rs1835740, а также условия проведения ПЦР подобраны в ООО «ДНК-Синтез», Москва: F: CTGACGAATATACTTATATTCCTTTTACAT, R: CTTGCATATTTGAGCAGACTTTG, rs1835740-C: FAM-CCAATCTGCGTATGTAGA-BHQ2, rs1835740-T: VIC-CAATCTGTGTATGTAG-BHQ2. Для проведения ПЦР в реальном времени использовали коммерческий набор qPCR mix (ЗАО «Евроген», Москва). ПЦР проводили на приборе CFX96 («BioRad», США), используя allelic discrimination тест. Условия ПЦР: 95 °С – 3’, 40 циклов 95 °С – 30’’, 57 °C – 60’’, 72 °C – 30’’.

Статистическую обработку проводили с использованием параметрических и непараметрических методов исследования в пакете программы IBM SPSS Statistics 22. Соответствие равновесию Харди-Вайнберга и ассоциацию с заболеванием в целом рассчитывали с использованием критерия согласия Пирсона (Хи-квадрат).

Таблица 1

Частоты аллелей и генотипов проанализированных генов, соответствие равновесию Харди-Вайнберга (df = 1)

 

Частоты генотипов

Частоты аллелей

CC

CT

TT

C

T

Пациенты

0,788

0,178

0,034

0,877

0,123

HWE

0,769

0,216

0,015

χ2 = 4,53; p = 0,03

Контроль

0,833

0,108

0,058

0,888

0,113

HWE

0,788

0,200

0,013

χ2 = 75,35; p = 0

Таблица 2

Генотипы rs1835740 у пациентов с мигренью, пучковой головной болью и хронической головной болью напряжения

Генотип

СС

СТ

ТТ

Мигрень, n/ %

112/78.3**

4/44.4

100/20

Пучковая головная боль, n/ %

29/20.3

2/22.2

0/0

Хроническая головная боль напряжения, n/ %

2/1.4*

3/33.3

0/0

Приммечание. * – мигрень vs пучковая головная боль, р = 0.001, ** – мигрень vs хроническая головная боль напряжения, р = 0.0001.

Таблица 3

Генотипы rs1835740 у пациентов с различными формами мигрени

Генотип

СС

СТ

ТТ

Эпизодическая мигрень (ЭМ), %

78.5

20.3

1.3

Хроническая мигрень (ХМ), %

79.6

20.5

0

ЭМ vs ХМ, p

0.8

0.9

0.4

Мигрень с аурой (МА), %

68.1

31.8

0

Мигрень без ауры (МбА), %

82.1

16.8

1.2

МА vs МбА, p

0.2

0.1

0.3

Результаты исследования и их обсуждение

Представленность частот генотипов и аллелей замены rs1835740 у пациентов с мигренью и контрольной выборкой представлена в таблице 1. Частоты генотипов не соответствуют равновесию Харди-Вайнберга. Поэтому для оценки связи с заболеванием мы использовали мультипликативную (частоты аллелей). Достоверных различий между пациентами с мигренью и здоровыми не получено (χ2 = 0.24, p = 0.63). В целом, распределение генотипов соответствует полученным другими авторами [2, 4].

При сравнении представленности генотипов rs1835740 среди пациентов с мигренью, пучковой (кластерной) головной болью и хронической головной болью напряжения (табл. 2) выявлено, что носительство Т-аллеля не характерно для пациентов с хронической головной болью напряжения, а представленность ТТ-генотипа наибольшая среди пациентов с кластерной головной болью.

Анализ генотипов rs1835740 среди различных форм мигрени (мигрень с аурой, мигрень без ауры, хроническая мигрень) различий не выявил (табл. 3).

При исследовании характеристик и симптомов мигрени у носителей и неносителей Т-аллеля rs1835740 не было выявлено статистически значимых различий по их представленности (табл. 4).

Как и в проводимых ранее исследованиях Christensen с соавторами [4] и Esserlind с соавторами [5] нами не получено статистически значимого влияния носительства минорного аллеля Т замены rs1835740 на формирование клинической картины мигрени с аурой и мигрени без ауры. Также нами показано, что полиморфизм rs1835740 не оказывает значимого влияния на развитие хронической мигрени.

Таблица 4

Представленность симптомов и клинических характеристик мигрени среди пациентов у носителей и неносителей Т-аллеля rs1835740

Симптом/клиническая характеристика

Носители С-аллеля,

Носители Т-аллеля

Значение р

Наличие мигрени у родственников, %

69.8 %

66.7 %

0.8

Возраст дебюта мигрени, лет

17.2 ± 8.5

20.2 ± 10.2

0.2

Продолжительность заболевания, лет

23.9 ± 12.6

20.9 ± 11.8

0.3

Частота приступов мигрени в месяц

9.0 ± 10.6

8.2 ± 8.3

0.7

Наличие ауры, %

16.1 %

29.2 %

0.1

Продолжительность приступов, часы

34.6 ± 25.2

36.5 ± 34.1

0.8

Интенсивность боли, баллы ВАШ

8.3 ± 1.5

8.5 ± 1.2

0.4

Время, за которое боль достигает высокой интенсивности, минуты

88.9 ± 71.8

115.9 ± 92.5

0.2

Пульсирующий характер боли

78.9 %

79.2 %

0.9

Кожная аллодиния, %

51.2 %

34.8 %

0.1

Возвраты головной боли, %

42.3 %

29.4 %

0.3

Тошнота, %

90.0 %

87.5 %

0.7

Рвота, %

45.5 %

50.0 %

0.7

Фотофобия, %

86.7 %

87.5 %

0.9

Фонофобия, %

85.6 %

83.3 %

0.8

Осмофобия, %

51.7 %

60.9 %

0.4

Наличие продромального периода, %

31.7 %

50.0 %

0.1

Наличие постдромального периода, %

29.5 %

31.6 %

0.8

Резистентность к стандартной терапии, %

17.7 %

4.0 %

0.09

Наличие лекарственного абузуса

36.7 %

26.9 %

0.3

Степень лекарственного абузуса (1 балл – легкая, до 30 разовых доз анальгетиков в месяц, 4 балла – тяжёлая – более 90 разовых доз анальгетиков в месяц)

2.3 балла

2.1 балла

0.7

naum1.tif

Роль Т-аллеля rs1835740 на «передозировку» глутамата в синаптической щели и возникновение РКД. Красным подсвечено патологическое увеличение количества молекул, синим – уменьшение. Выбелен белок MTDH. Подробное описние в тексте. Подготовлено в программе Pathway Studio 10.0 (Elsevier)

Проведённое нами исследование позволяет предположить, что носительство Т-аллеля rs1835740 является специфичным для пациентов с мигренью и пучковой головной болью, и не характерно для пациентов с хронической головной болью напряжения. Возможно, нарушение гомеостаза глутамата является общим звеном патогенеза для мигрени и кластерной головной боли, обеспечивающим формирование корковой нейрональной гипервозбудимости [3]. Влияние аллеля Т на сигнальные пути, приводящие к изменению в гомеостазе глутамата и, как следствие, к распространяющейся корковой депрессии (РКД) и ауре продемонстрировано на рисунке.

Белок MTDH является блокатором экспрессии одного из основных переносчиков глутамата из синаптического пространства в астроцит – SLC1A2. В астроците глутамат преобразуется в глутамин и передаётся в пресинаптический нейрон, где он снова конвертируется в глутамат. Аллель Т замены rs1835740 приводит к усиленной транскрипции гена MTDH, что приводит к снижению экспрессии SLC1A2. В результате глутамат накапливается синаптической щели и постоянно активирует NMDA рецепторы на постсинаптических нейронах, что приводит к выбросу калия на поверхность клетки из внутриклеточного пространства и входу кальция в клетку. Внеклеточный калий вызывает деполяризации мембраны. Гипердеполяризация является основой для возникновения РКД – распространяющейся деполяризации клеток мозга. Аура, предшествующая мигренозному приступу, является следствием РКД. Эффект деполяризации усиливается активацией фосфолипазы А (PLA2G4A) через кальций зависимые пути в постсинаптическом нейроне. Фосфолипаза синтезирует арахидоновую кислоту, которая блокирует калиевый канал и калий остаётся на поверхности мембраны.

Наличие распространяющейся корковой депрессии, и её клинического коррелята ауры, как правило, обсуждается в контексте нейрональной гипервозбудимости при мигрени. Однако до 23 % пациентов с пучковой головной болью могут отмечать типичную мигренозную ауру перед приступом головной боли [7], тогда как в основе развития хронической головной боли напряжения лежит в большей степени дефицит центральных противоболевых систем. Следовательно, аллель Т rs1835740, обуславливающий повышение уровня межклеточного глутамата, обеспечивает запуск РКД и начало приступа. Это предположение подтверждается данными геномного исследования Anttila с соавторами, где было показано большее влияние полиморфизма rs1835740 на развитие мигрени с аурой [2].

Выводы

Таким образом, полиморфизм rs1835740 является несомненным фактором риска развития мигрени, однако для возникновения заболевания и формирования клинической картины необходимы и другие внешние и внутренние, в том числе и другие генетические факторы, требующие дальнейшего изучения.


Библиографическая ссылка

Наумова Е.А., Азимова Ю.Э., Кондратьева Н.С., Анучина А.А., Сергеев А.В., Скоробогатых К.В., Кокаева З.Г., Рудько О.И., Табеева Г.Р., Климов Е.А. СВЯЗЬ АЛЛЕЛЯ T ЗАМЕНЫ XR_928434.1:N.1748 + 4013T > C С МИГРЕНЬЮ, ПУЧКОВОЙ И ХРОНИЧЕСКОЙ ГОЛОВНЫМИ БОЛЯМИ // Международный журнал прикладных и фундаментальных исследований. – 2016. – № 10-2. – С. 258-262;
URL: https://www.applied-research.ru/ru/article/view?id=10331 (дата обращения: 12.05.2021).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074