Научный журнал
Международный журнал прикладных и фундаментальных исследований

ISSN 1996-3955
ИФ РИНЦ = 0,580

ГЕНЕТИЧЕСКИЙ ПОЛИМОРФИЗМ ИЗОЛЯТОВ БАКТЕРИЙ SALMONELLA, ВЫДЕЛЕННЫХ ИЗ ПРОДУКТОВ ПИТАНИЯ

Бармак С.М. 1, 2 Синявский Ю.А. 2 Бердыгалиев А.Б. 2 Шарманов Т.Ш. 2 Менденхалл И.Х. 3 Жолдыбаева Е.В. 4
1 Казахский Национальный университет им. Аль-Фараби
2 Казахская академия питания
3 Медицинская школа Duke-NUS
4 Национальный центр биотехнологии
Проведена молекулярно-генетическая идентификация изолятов бактерий Salmonella, выделенных из продуктов питания. ПЦР анализ с видоспецифичным праймером S Inv-1F и S Inv-1R показал положительный результат с ДНК 25 изолятов Salmonella enterica. С наибольшей частотой сальмонеллы обнаруживаются в мясе птицы – 36 %, рыбе – 4 %, яйцах – 20 %, молочной продукции – 12 %, растительных салатах – 4 %. В сыром мясе и колбасных изделиях сальмонеллы присутствовали в 24 % проб. При типировании исследованных ДНК 25 изолятов, выделенных из цепи пищевых продуктов, было выявлено, что 14 изолятов (56 %) относятся к бактерии Salmonella enterica Typhimurium, 8 изолятов – к бактерии Salmonella enterica Еnteritidis (32 %), 3 изолята – к бактерии Salmonella enterica Virchow (12 %). Генетическое разнообразие изолятов бактерий Salmonella определено с использованием RАPD ПЦР. Для 3 типов бактерии Salmonella enterica был выявлен специфический набор ДНК-фрагментов, отличающих их друг от друга. Проведенный RАPD-ПЦР анализ геномной ДНК бактерий Salmonella enterica показал генетическое родство 8 изолятов Salmonella enterica Еnteritidis, такие же результаты показали 3 изолята Salmonella enterica Virchow. Исследованные изоляты Salmonella enterica Typhimurium показали генетическую гетерогенность.
генетический полиморфизм
бактериальные изоляты
праймер
продукты питания
Salmonella
1. Чугунова Е.О., Татарникова Н.А. Сальмонеллез сельскохозяйственных животных и птиц: характеристика возбудителя, распространенность в пермском крае и эпидемиологическое значение: учебное пособие. Пермь: Прокростъ, 2014. 63 с.
2. Тимофеева М.А., Ларина O.Н., Шкиль Н.А. Биологические свойства и чувствительность к антибиотикам бактерий рода Salmonella, изолированных из продукции птицеводства // Вестник НГАУ (Новосибирский государственный аграрный университет). 2019. № 3. С. 112–119. DOI: 10.31677/2072-6724-2019-52-3-112-119.
3. Слизень В.В., Гудкова Е.И., Скороход Г.А. Разработка метода пцр для экспрессидентификации Salmonella spp. и среди них Salmonella enteritidis // Инновации в медицине: сборник научных трудов. Минск: БГМУ, 2012. 6 с.
4. Рождественская Т.Н., Яковлев С.С., Кононенко Е.В. Профилактика сальмонеллеза птиц // Farm Animals. 2012. № 1 (1). С. 54–56.
5. Lal A., Hales S., French N., Baker M.G. Seasonality in Human Zoonotic Enteric Diseases: A Systematic Review. PLoS ONE. 2012. V. 7(4). Р. e31883. DOI: 10.1371/journal.pone.0031883.
6. Simpson K.M.J., Hill-Cawthorne G.A., Ward M.P., Diversity of Salmonella serotypes from humans, food, domestic animals and wildlife in New South Wales, Australia. BMC Infect. 2018. V. 623. DOI: 10.1186/s12879-018-3563-1.
7. Mukherjee N., Nolan V.G., Dunn J.R., Banerjee P. Sources of human infection by Salmonella enterica serotype Javiana: A systematic review. PLoS ONE. 2019. V. 14(9). Р. e0222108. DOI: 10.1371/journal.pone.0222108.
8. Шуляк Б.Ф. Традиционные и новые подходы к лабораторной диагностике сальмонеллеза // Справочник заведующего КДЛ. 2009. № 12. С. 21–26.
9. Межгосударственный стандарт ГОСТ 31904-2012. Продукты пищевые. Методы отбора проб для микробиологических испытаний. М.: Стандартинформ, 2014. 10 с.
10. ГОСТ Р 52814-2007 (ИСО 6579:2002). Продукты пищевые. Метод выявления бактерий рода Salmonella. М.: Стандартинформ, 2010. 22 с.
11. ГОСТ Р 50455-92. Мясо и мясные продукты. Обнаружение сальмонелл (арбитражный метод). М.: Стандартинформ, 2010. 14 с.
12. Терлецкий В.П., Усенбеков Е.С., Жансеркенова О.О. Генотипирование штаммов микроорганизмов методом ДРИМ (двойное расщепление и избирательное мечение) // Исследования, результаты. 2016. № 3(71). С. 86–91.

Пищевые сальмонеллезы – широко распространенные заболевания человека, их регистрируют во всех странах, на всех континентах [1]. Болезнь имеет эпизоотологическое, эпидемиологическое, экологическое и социально-экономическое значение и представляет серьезную потенциальную угрозу для людей [2]. Актуальность проблемы сальмонеллы связана с высоким уровнем заболеваемости и сохраняющейся тенденцией к ее росту, трудностями в эпидемиологическом исследовании причин сальмонеллы, формированием устойчивости к противомикробным препаратам и отсутствием эффективной специфической профилактики. Быстрая диагностика сальмонеллы и методы типирования сальмонеллы являются наиболее важными моментами в подавлении распространения патогенных микроорганизмов [3].

По заключению Комитета экспертов ВОЗ, сальмонеллез не имеет себе равных по сложности диагностики, профилактики и лечения [4].

Пищевой сальмонеллез является широко распространенным заболеванием человека, регистрируется во всех странах, на всех континентах; сальмонеллы поражают человека и сохраняются в окружающей среде в течение длительного времени [5].

Большинство сальмонелл являются патогенными как для людей, так и для животных и птиц, но в эпидемиологическом отношении только несколько серотипов являются наиболее значимыми для людей, их доля составляет 85–91 % сальмонелл во всем мире [6].

Возбудитель Salmonella enterica живет в основном в кишечнике, но, выделяясь с калом, он загрязняет почву и объекты окружающей среды, через которые он может передаваться восприимчивым животным и людям. Однако чаще заражение сальмонеллой происходит при непосредственном контакте с источником инфекции или при употреблении пищи, зараженной Salmonella enterica. Согласно существующей классификации [7] Salmonella enterica подразделяется на 6 подвидов: enterica, salamae, arizonae, diarizonae, houtenae и indica, которые различаются по биохимической активности и обозначены номерами I, II, IIIa, IIIb, IV и VI соответственно. В подавляющем большинстве случаев сальмонеллезной инфекции от людей изолируют серовары подвида enterica [8].

Цель исследования: определение генетического полиморфизма изолятов бактерий Salmonella, выделенных из продуктов питания, доступных потребителям на местных торговых точках.

Материалы и методы исследования

Бактериальные изоляты

25 изолятов сальмонеллы, использованных в этом исследовании, были получены из пищевых продуктов (табл. 1). Отбор проб для исследования проводили по ГОСТ 31904-2012 «Продукты пищевые. Методы отбора проб для микробиологических испытаний» [9].

Таблица 1

Изоляты бактерии Salmonella, выделенные из пищевых продуктов в 2018 г.

Рег. номер

Использованные продукты

Рег. номер

Использованные продукты

1

8

Куриная печень

14

67

Сердце индейки

2

9

Яйца

15

69

Фарш говядина/курица

3

24

Фарш баранина/говядина

16

70

Яйцо промышленной птицефабрики

4

26

Голень индейки замороженная

17

86

Мороженое

5

27

Тушка цыпленка бройлера замороженная

18

90

Баранина

6

31

Желудок цыпленка

19

70/1

Яйцо промышленной птицефабрики

7

34

Яйца якорские

20

96

Рыба лещ

8

37

Яйца домашние

21

120

Сало свиное

9

39

Фарш куриный

22

121

Говядина

10

40

Голень куриная

23

124

Сосиски детские

11

46

Капуста цветная/салат

24

125

Сосиски говяжьи

12

53

Творог домашний

25

126

Брынза

13

63

Фарш куриный

     

В процессе работы применяли культуральные методы с использованием специальных селективных и дифференциально-диагностических сред. Культуральные, морфологические, и биохимические свойства выделенных микроорганизмов изучали общепринятыми методами и в соответствии с ГОСТ Р 52814-2007 (ИСО 6579:2002) «Продукты пищевые. Метод выявления бактерий рода Salmonella» [10] и ГОСТ Р 50455-92 «Мясо и мясные продукты. Обнаружение сальмонелл (арбитражный метод)» [11].

Выделение ДНК. Выделение ДНК из бактерий Salmonella проводили тризольным методом с использованием коммерческого реагента TRizol («Invitrogen», США) в соответствии с инструкцией производителя.

Олигонуклеотидные праймеры для выявления бактерии Salmonella

Определение вида и типа бактерии Salmonella осуществляли с помощью ПЦР анализа, используя специфические праймеры (табл. 2).

Таблица 2

Праймеры, используемые для выявления вида и типа бактерии Salmonella

Название праймера

Олигонуклеотиды

Размер ПЦР продукта, п.о.

Вид и тип бактерии Salmonella

1

SInv-1F

GTGAAATTATCGCCACGTTCGG

500

Salmonella enterica

SInv-1R

ATCGCCATTTACGCGGGTCA

2

SE Prot6e-1F

TAACCGGAGAGGCGCTCATC

300

Salmonella enterica Enteritidis

SE Prot6e-1R

AACCATGCTCAGCTGCTCCA

3

ST mdh-1F

TGCCGCTGCTGTCGCAGATT

200

Salmonella enterica Typhimurium

ST mdh-1R

CACCACGCCCTTCTCGCCCT

4

SVCRISPR-1F

AGCCGCAGGATGTGCTGGAA

400

Salmonella enterica Virchow

SVCRISPR-1R

GATAAACCGCCGCGCCTTAT

5

hgbAa (RAPD ПЦР)

GCG GGA ATG CTG AAG ATA AG

Salmonella enterica

Постановка ПЦР для идентификации сальмонелл. Получение ПЦР-фрагмента гена Inv бактерии Salmonella enterica проводили с использованием праймеров: S Inv-1F и S Inv-1R (размер ПЦР продукта 500 п.о.). Следующие праймеры использованы для типизации: для типа Еnteritidis бактерии Salmonella enterica – SE Prot6e-1F и SE Prot6e-1R (размер ПЦР продукта 300 п.о.); для типа Typhimurium бактерии Salmonella enterica – ST mdh-1F и ST mdh-1R (размер ПЦР продукта 200 п.о.); для типа Virchow бактерии Salmonella enterica – SV CRISPR-1F и SV CRISPR-1R (размер ПЦР продукта 400 п.о.).

Амплификацию проводили в 25 мкл реакционной смеси следующего состава: 10xбуфер ДНК полимеразы – 2,5 мкл, 10 mM dNTP – 1 мкл., MgCl2 – 1 мкл, 20-50 нг ДНК-матрицы, по 20 пмоль прямого и обратного праймеров и 0,5 ед. TaqДНК полимеразы (Invitrogen). Анализ продуктов ПЦР проводили при помощи электрофореза в 1,5 %-ном агарозном геле, содержащем бромистый этидий (1 мкг/мл), при напряженности поля 6 В/см2.

Постановка RAPD (Random Amplification of Polymorphic DNA) ПЦР

Для постановки RAPD ПЦР используют праймер: hgbAa –GCG GGA ATG CTG AAG ATA AG. Реакционный состав:10х буфер – 2,5 мкл; dNTPs – 1 мкл; MgCl2 – 1 мкл; праймер – 2 мкл; 0,5 ед.TaqДНК полимеразы – 0,5 мкл; ДНК – 5 мкл; вода – до 25 мкл. Температурный режим амплификации: 94 °С – 5 мин; 40 циклов 94 °С – 45 сек, 35 °С – 5 сек, 72 °С – 1,20 мин; 72 °С – 10 мин.

Результаты исследования и их обсуждение

Осуществлено исследование 25 образцов пищевых продуктов на содержание в них бактерий Salmonella. Проведен ПЦР анализ с использованием видоспецифичных праймеров SInv-1F и SInv-1R для определения вида enterica бактерии Salmonella. Для типирования бактерии Salmonella вида enterica с помощью ПЦР-анализа использованы олигонуклеотидные праймеры: 1) для типа Еnteritidis бактерии Salmonella enterica – SE Prot6e-1F и SE Prot6e-1R; 2) для типа Typhimurium бактерии Salmonella enterica – ST mdh-1F и ST mdh-1R; 3) для типа Virchow бактерии Salmonella enterica – SV CRISPR-1F и SV CRISPR-1R.

При типировании исследованных ДНК 25 изолятов, выделенных из цепи пищевых продуктов, было выявлено: 14 изолятов (56 %) бактерии Salmonella enterica Typhimurium, 8 изолятов бактерии Salmonella enterica Еnteritidis (32 %), 3 изолята бактерии Salmonella enterica Virchow (12 %).

С наибольшей частотой сальмонеллы обнаруживаются в мясе птицы – 36 %, рыбе – 4 %, яйцах – 20 %, молочной продукции – 12 %, растительных салатах – 4 %. В сыром мясе и колбасных изделиях сальмонеллы присутствовали в 24 % проб.

Генетический полиморфизм изолятов бактерии Salmonella enterica, полученных из цепи пищевых продуктов

Для выявления генетического разнообразия изолятов Salmonella enterica Еnteritidis, Salmonella enterica Typhimurium и Salmonella enterica Virchow проведен ПЦР анализ с использованием RАPD-праймера.

Результаты выявления генетического разнообразия исследуемых изолятов Salmonella enterica Еnteritidis, Salmonella enterica Typhimurium и Salmonella enterica Virchow, полученных из цепи пищевых продуктов, представлены в табл. 3 и на рисунке.

barm1.tif

Электрофореграмма разделения ПЦР продуктов изолятов Salmonella enterica, полученных из цепи пищевых продуктов с использованием RАPD-праймера

Таблица 3

Характеристики изолятов бактерии Salmonella, выявленных из цепи производства пищевых продуктов методами ПЦР и RAPD ПЦР

Рег. номер штамма

Использованные продукты

Вид бактерии Salmonella

Тип Salmonella enterica

Размеры ампликонов в RAPD ПЦР, п.о.

1

8

Куриная печень

Salmonella enterica

Typhimurium

250, 350, 1000, 1250

2

9

Яйца

Salmonella enterica

Еnteritidis

250, 350, 650, 1000, 1250, 3000

3

24

Фарш баранина

Salmonella enterica

Typhimurium

250, 350, 1000, 1250

4

26

Голень индейки

Salmonella enterica

Еnteritidis

250, 350, 650, 1000, 1250, 3000

5

27

Тушка цыпленка бройлера

Salmonella enterica

Typhimurium

250, 350, 1000, 1250

6

31

Желудок цыпленка

Salmonella enterica

Еnteritidis

250, 350, 650, 1000, 1250, 3000

7

34

Яйца якорские

Salmonella enterica

Typhimurium

250, 350, 1000, 1250

8

37

Яйца домашние

Salmonella enterica

Еnteritidis

250, 350, 650, 1000, 1250, 3000

9

39

Фарш куриный

Salmonella enterica

Typhimurium

250, 350, 1000, 1250

10

40

Голень куриная

Salmonella enterica

Typhimurium

250, 350, 1000, 1250

11

46

Капуста цветная

Salmonella enterica

Typhimurium

250, 350, 1000

12

53

Творог домашний

Salmonella enterica

Typhimurium

250, 350, 1000, 1250

13

63

Фарш куриный

Salmonella enterica

Typhimurium

250, 350, 1000

Окончание табл. 3

Рег. номер штамма

Использованные продукты

Вид бактерии Salmonella

Тип Salmonella enterica

Размеры ампликонов в RAPD ПЦР, п.о.

14

67

Сердце индейки

Salmonella enterica

Typhimurium

250, 350, 1000, 1250

15

69

Фарш курица

Salmonella enterica

Typhimurium

250, 350, 1000, 1250

16

70

Яйцо птицефабрики

Salmonella enterica

Еnteritidis

250, 350, 650, 1000, 1250, 3000

17

86

Мороженое

Salmonella enterica

Virchow

200, 650, 1200

18

90

Баранина

Salmonella enterica

Typhimurium

250, 350, 1000, 1250

19

70/1

Яйцо птицефабрики

Salmonella enterica

Typhimurium

250, 350, 1000, 1250

20

96

Рыба лещ

Salmonella enterica

Typhimurium

250, 350, 1000, 1250

21

120

Сало свиное

Salmonella enterica

Еnteritidis

250, 350, 650, 1000, 1250, 3000

22

121

Говядина

Salmonella enterica

Virchow

200, 650, 1200

23

124

Сосиски детские

Salmonella enterica

Еnteritidis

250, 350, 650, 1000, 1250, 3000

24

125

Сосиски говяжьи

Salmonella enterica

Virchow

200, 650, 1200

25

126

Брынза

Salmonella enterica

Еnteritidis

250, 350, 650, 1000, 1250, 3000

При помощи данного RAPD-праймера был получен одинаковый специфический набор ДНК-фрагментов бактерии Salmonella enterica Еnteritidis, не отличающих их друг от друга. Показано, что для этих изолятов было выявлено по 6 ампликонов длиной 250, 350, 650, 1000, 1250, 3000 п.о., что говорит об их генетическом родстве.

При генотипировании изолятов Salmonella enterica Typhimurium под номерами 1,3, 5, 7, 9, 10, 11, 12, 13, 14, 15, 18, 19 и 20 (1-я группа) было выявлено 4 ампликона (200, 350, 1000, 1250 п.н.), а для изолятов Salmonella enterica Typhimurium под номерами 15 и 19 (2-я группа) были получены по 3 ампликона (200, 350, 1000 п.н.). В результате амплификации геномной ДНК изолятов RAPD-праймером был получен специфический набор ДНК-фрагментов, отличающих их друг от друга. Изоляты 1-й группы генетически отличаются от изолятов 2-й группы бактерии Salmonella enterica Typhimurium.

В изолятах Salmonella enterica Virchow были выявлены по 3 ампликона длиной 200, 650, 1200 п.о. Эти данные являются показателями их генетического родства.

Существуют генетические различия между штаммами возбудителей различных заболеваний. При накоплении достаточного количества мутаций в штаммах методы генотипирования начинают различать изоляты. В некоторых случаях изоляты не отличаются распределением фрагментов ДНК, что указывает на генетическую близость этих изолятов. В таких случаях они являются генетически идентичными или отличаются друг от друга на уровне только одного или нескольких генов, полиморфизм которых ускользает от скрининга [12].

Обнаружение различных типов изолятов Salmonella enterica, циркулирующих на территории Республики Казахстан, указывает на необходимость проведения более углубленных генетических исследований.

Выводы

При типировании изолятов Salmonella enterica, полученных из цепи пищевых продуктов, выявлено 14 изолятов (56 %) бактерии Salmonella enterica Typhimurium, 8 изолятов бактерии Salmonella enterica Еnteritidis (32 %), 3 изолята бактерии Salmonella enterica Virchow (12 %).

Проведен молекулярный анализ с использованием RАPD ПЦР для выявления генетического разнообразия изолятов бактерий Salmonella enterica, полученных из цепи пищевых продуктов. В RАPD ПЦР 8 изолятов Salmonella enterica Еnteritidis показали генетическое родство с одинаковым количество ампликонов (50, 350, 650, 1000, 1250, 3000 п.о.). Близкое генетическое родство выявлено у 3 изолятов Salmonella enterica Virchow (200, 650, 1200 п.о.) В изолятах Salmonella enterica Typhimurium, выделенных из цепи пищевых продуктов, обнаружены две генетически отличающиеся группы с разным набором ДНК-фрагментов.


Библиографическая ссылка

Бармак С.М., Синявский Ю.А., Бердыгалиев А.Б., Шарманов Т.Ш., Менденхалл И.Х., Жолдыбаева Е.В. ГЕНЕТИЧЕСКИЙ ПОЛИМОРФИЗМ ИЗОЛЯТОВ БАКТЕРИЙ SALMONELLA, ВЫДЕЛЕННЫХ ИЗ ПРОДУКТОВ ПИТАНИЯ // Международный журнал прикладных и фундаментальных исследований. – 2020. – № 6. – С. 7-11;
URL: https://www.applied-research.ru/ru/article/view?id=13080 (дата обращения: 20.01.2021).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074